Order Kazusa clone(s) from : ![]() |
Product ID | ORK07220 |
---|---|
Accession No | AB046836 |
Description | transient receptor potential cation channel, subfamily M, member 3 |
Clone name | fj13825 |
Vector information | |
cDNA sequence | DNA sequence (3957 bp) Predicted protein sequence (1017 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1616
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 901 bp |
---|---|
Genome contig ID | gi89161216r_72239788 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 72339788 | 72424836 | 11 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 183 | FWFYTLAYIGYLMLFNYIVLVKM | 205 | PRIMARY | 23 | 2 | 250 | YWNVTDLIAILLFSVGMILRLQD | 272 | PRIMARY | 23 | 3 | 279 | GRVIYCVNIIYWYIRLLDIFGVN | 301 | SECONDARY | 23 | 4 | 312 | GKMMIDMMYFVIIMLVVLMSFGV | 334 | PRIMARY | 23 | 5 | 403 | MACYLLVANILLVNLLIAVFNNT | 425 | PRIMARY | 23 |
---|
![]() |
Primer_f | CCACAGAAGGCTCAAGAATCC |
---|---|
Primer_r | GCCTTAAATCCCCTGTGTCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | CCACAGAAGGCTCAAGAATCC |
Primer_r | GCCTTAAATCCCCTGTGTCTG |
PCR product length | 198 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |