KIAA1865

Gene/Protein Characteristic Table for KIAA1865

Order Kazusa clone(s) from :

Product ID	ORK04852
Accession No	AB058768
Description	interferon regulatory factor 2 binding protein-like
Clone name	fj14303
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3641 bp) Predicted protein sequence (723 aa)
Source	Human fetal brain
Rouge ID	mKIAA1865 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3641 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	848 bp
Genome contig ID	gi51511730r_76460641
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GAGCTTAGTAACTTGTAATAAATTCAATTGATATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGCGCTGAGTCAGCAATTTTGTCTTTCTAGGGCTAAGGCCATGCAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	76560641	76564375	2	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 723 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9H1B7	3.7e-183	99.7	Enhanced at pub...	Homo sapiens
Q2MJS2	9.3e-183	99.3	Enhanced at pub...	Macaca mulatta
XP_510088	3.4e-182	99.9	chromosome 14 o...	Pan troglodytes
XP_001928351	1.5e-179	98.0	similar to poly...	Sus scrofa
Q5EIC4	3.2e-177	96.8	Enhanced at pub...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGTGCACCCCCAAAACATTCC
Primer_r	GGGCCTTGATACTCTCTCTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 14

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp