Order Kazusa clone(s) from : ![]() |
Product ID | ORK04852 |
---|---|
Accession No | AB058768 |
Description | interferon regulatory factor 2 binding protein-like |
Clone name | fj14303 |
Vector information | |
cDNA sequence | DNA sequence (3641 bp) Predicted protein sequence (723 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1865
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 848 bp |
---|---|
Genome contig ID | gi51511730r_76460641 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 76560641 | 76564375 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AGTGCACCCCCAAAACATTCC |
---|---|
Primer_r | GGGCCTTGATACTCTCTCTAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |