KIAA1618

Gene/Protein Characteristic Table for KIAA1618

Order Kazusa clone(s) from :

Product ID	ORK05680
Accession No	AB046838
Description	ring finger protein 213
Clone name	fj14314
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4644 bp) Predicted protein sequence (1415 aa)
Source	Human fetal brain

Features of the cloned cDNA sequence

Description

Length: 4644 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	396 bp
Genome contig ID	gi51511734f_75776353
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGAGTGACAAAGTGAGACTCTGTCTC
Flanking genome sequence (148944 - 148993)	----+--------+--------+--------+--------+----* AAAAAAAAGAAAAGAAAAGAAAAAAGTAAACATTTAAGTTTAAGTAAACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	75876353	75925295	20	99.8	Perfect prediction

Features of the protein sequence

Description

Length: 1415 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9HCF4	0	100.0	Protein ALO17; ...	Homo sapiens
NP_066005	0	100.0	hypothetical pr...	Homo sapiens
CAH10615	0	99.1	hypothetical pr...	Homo sapiens
XP_590465	1.4e-202	55.0	similar to mCG1...	Bos taurus
EDL34702	2.8e-196	48.6	mCG142721, isof...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000005	1343	1386	PS00041	Helix-turn-helix

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGCGTGGACTTCAGTGCATTC
Primer_r	ACTGCCCTAACGTTGCTAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	CCR
Primer_f	AGCGTGGACTTCAGTGCATTC
Primer_r	ACTGCCCTAACGTTGCTAAGC
PCR product length	152 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp