Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07606 |
---|---|
Accession No | AB058702 |
Description | EF-hand calcium binding domain 7 |
Clone name | fj20761 |
Vector information | |
cDNA sequence | DNA sequence (3973 bp) Predicted protein sequence (610 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1799
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR002048 | 107 | 170 | PD000012 | Calcium-binding EF-hand |
HMMPfam | IPR002048 | 110 | 138 | PF00036 | Calcium-binding EF-hand |
IPR002048 | 146 | 174 | PF00036 | Calcium-binding EF-hand | |
IPR002048 | 411 | 432 | PF00036 | Calcium-binding EF-hand | |
HMMSmart | IPR002048 | 110 | 138 | SM00054 | Calcium-binding EF-hand |
IPR002048 | 146 | 174 | SM00054 | Calcium-binding EF-hand | |
IPR002048 | 411 | 439 | SM00054 | Calcium-binding EF-hand | |
ProfileScan | IPR002048 | 106 | 141 | PS50222 | Calcium-binding EF-hand |
IPR002048 | 142 | 177 | PS50222 | Calcium-binding EF-hand | |
IPR002048 | 407 | 442 | PS50222 | Calcium-binding EF-hand | |
ScanRegExp | IPR002048 | 420 | 432 | PS00018 | Calcium-binding EF-hand |
RT-PCR-ELISA |
Primer_f | AAGCTAATGATCGAGAAGGAG |
---|---|
Primer_r | ATTACTTTGGCATCACCGTTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |