Gene/Protein Characteristic Table for KIAA1799
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07606
Accession No AB058702
Description EF-hand calcium binding domain 7
Clone name fj20761
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3973 bp)
Predicted protein sequence (610 aa)
Source Human fetal brain
Rouge ID mKIAA1799 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3973 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 610 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH15814 0 99.5 EF-hand calcium...
Homo sapiens
XP_513455 0 99.0 hypothetical pr...
Pan troglodytes
XP_001499786 0 88.9 similar to EF-h...
Equus caballus
BAE24969 1.2e-206 83.2 unnamed protein...
Mus musculus
Q8VDY4 3.3e-206 83.1 EF-hand calcium...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002048 107 170 PD000012 Calcium-binding EF-hand
HMMPfam IPR002048 110 138 PF00036 Calcium-binding EF-hand
IPR002048 146 174 PF00036 Calcium-binding EF-hand
IPR002048 411 432 PF00036 Calcium-binding EF-hand
HMMSmart IPR002048 110 138 SM00054 Calcium-binding EF-hand
IPR002048 146 174 SM00054 Calcium-binding EF-hand
IPR002048 411 439 SM00054 Calcium-binding EF-hand
ProfileScan IPR002048 106 141 PS50222 Calcium-binding EF-hand
IPR002048 142 177 PS50222 Calcium-binding EF-hand
IPR002048 407 442 PS50222 Calcium-binding EF-hand
ScanRegExp IPR002048 420 432 PS00018 Calcium-binding EF-hand
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AAGCTAATGATCGAGAAGGAG
Primer_r ATTACTTTGGCATCACCGTTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp