Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05551 |
---|---|
Accession No | AB075833 |
Description | inter-alpha-trypsin inhibitor heavy chain family, member 5 |
Clone name | fk00837 |
Vector information | |
cDNA sequence | DNA sequence (3132 bp) Predicted protein sequence (824 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1953
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 656 bp |
---|---|
Genome contig ID | gi89161187r_7544395 |
PolyA signal sequence (ATTAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 7644395 | 7722770 | 11 | 99.7 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002035 | 176 | 193 | PR00453 | von Willebrand factor |
IPR002035 | 282 | 290 | PR00453 | von Willebrand factor | |
HMMPfam | IPR013694 | 6 | 43 | PF08487 | Vault protein inter-alpha-trypsin |
IPR002035 | 177 | 360 | PF00092 | von Willebrand factor | |
IPR010600 | 597 | 791 | PF06668 | Inter-alpha-trypsin inhibitor heavy chain | |
HMMSmart | IPR002035 | 175 | 358 | SM00327 | von Willebrand factor |
ProfileScan | IPR002035 | 177 | 360 | PS50234 | von Willebrand factor |
RT-PCR-ELISA |
Primer_f | TTCCCCAACTACTTCAACGGC |
---|---|
Primer_r | CATCTTTCCCTGCCTTCTGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |