KIAA0683

Product ID	ORK00115
Accession No	AB014583
Description	telomere maintenance 2
Clone name	fk02589
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3309 bp) Predicted protein sequence (844 aa)
HaloTag ORF Clone	FHC00115
Flexi ORF Clone	FXC00115
Source	Human fetal brain
Rouge ID	mKIAA0683 by Kazusa Mouse cDNA Project
Note	We replaced hk02952, former representative clones for KIAA0683 with fk02589. (2005/08/06)

Length: 3309 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	516 bp
Genome contig ID	gi51511732f_1383365
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGCACGGGCTCTCAGAAAATAAACTGCTTTATTGG
Flanking genome sequence (117091 - 117140)	----+--------+--------+--------+--------+----* AATTACAGGAGTGTTGGTGGCCGGTGGGCAGAGCCTAGCAGGGGGTGCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	1483365	1500454	21	99.8	Perfect prediction

Length: 844 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10366	100.0	telomere mainte...	synthetic construct
XP_001089282	94.0	similar to CG31...	Macaca mulatta
EDL22399	74.9	RIKEN cDNA 1200...	Mus musculus
EDL22400	74.8	RIKEN cDNA 1200...	Mus musculus
XP_220236	75.1	similar to CG31...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GGCCCAGTGTATTTTTAGCAG
Primer_r	TTGTAGCGAGGCCAGGTCTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GGCCCAGTGTATTTTTAGCAG
Primer_r	TTGTAGCGAGGCCAGGTCTTC
PCR product length	111 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles