KIAA1857

Product ID	ORK00933
Accession No	AB058760
Description	netrin G2
Clone name	fk03350
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3083 bp) Predicted protein sequence (549 aa)
HaloTag ORF Clone	FHC00933
Flexi ORF Clone	FXC00933
Source	Human fetal brain
Rouge ID	mKIAA1857 by Kazusa Mouse cDNA Project
Note	We replaced fh05673, former representative clones for KIAA1857 with fk03350. (2002/5/10)

Length: 3083 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	714 bp
Genome contig ID	gi89161216f_133927314
PolyA signal sequence (AGTAAA,-16)	+--------+--------+----*----+---- GATGGTGGAGAATCCGAGGAGTAAAGAGTTTGCTC
Flanking genome sequence (180720 - 180769)	----+--------+--------+--------+--------+----* ACTGCTGCCTCCACGGCCTGTTTTCTTTCTGTGTTGGGGACGGTGGGCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	134027155	134108032	7	99.2	Perfect prediction

Length: 549 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96CW9	100.0	Netrin-G2; Lami...	Homo sapiens
CAI16125	99.8	netrin G2 [Homo...	Homo sapiens
XP_001105036	99.6	similar to netr...	Macaca mulatta
CAI16126	98.3	netrin G2 [Homo...	Homo sapiens
XP_001167978	97.2	netrin G2 isofo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023193	9e-79	57.5	KIAA0976
AB067494	3.4e-21	30.0	KIAA1907
AB011542	1.2e-09	24.7	KIAA0818
AB058676	4.8e-07	29.3	KIAA1780
AB058677	1.8e-06	29.2	KIAA1781

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008211	58	304	PF00055	Laminin
	IPR002049	306	363	PF00053	EGF-like
	IPR002049	372	425	PF00053	EGF-like
	IPR002049	428	470	PF00053	EGF-like
	IPR006209	475	505	PF00008	EGF-like
HMMSmart	IPR008211	52	304	SM00136	Laminin
	IPR002049	306	363	SM00180	EGF-like
	IPR002049	372	425	SM00180	EGF-like
	IPR002049	428	470	SM00180	EGF-like
	IPR006210	474	506	SM00181	EGF
ProfileScan	IPR008211	54	305	PS51117	Laminin
	IPR002049	306	365	PS50027	EGF-like
	IPR002049	372	427	PS50027	EGF-like
	IPR002049	428	472	PS50027	EGF-like
	IPR000742	471	506	PS50026	EGF-like
ScanRegExp	IPR013032	324	335	PS00022	EGF-like region
	IPR002049	392	428	PS01248	EGF-like
	IPR013032	446	457	PS00022	EGF-like region
	IPR002049	446	475	PS01248	EGF-like
	IPR013032	494	505	PS00022	EGF-like region
	IPR013032	494	505	PS01186	EGF-like region

Primer_f	AAGACCTGGATTGATTGGAAG
Primer_r	ATGGACAGATCAGAAAGTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCTGCTCTCACCTGGACTCAC
Primer_r	TGGTCATCGTCTTCCTGGTGC
PCR product length	95 bp
PCR conditions	15 °C66 sec60 °C30 sec112 cycles