KIAA1987

Gene/Protein Characteristic Table for KIAA1987

Order Kazusa clone(s) from :

Product ID	ORK04292
Accession No	AB075867
Description	SLX4 structure-specific endonuclease subunit
Clone name	fk04103
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3228 bp) Predicted protein sequence (357 aa)
Source	Human fetal brain

Features of the cloned cDNA sequence

Description

Length: 3228 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi51511732r_3485613
PolyA signal sequence (None)	+--------+--------+----*----+---- CATCGCAGGACAAGCACCCGGACAGGGGCGGCCGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTTGGTAAGAACTGGCTCTGGCCCGCGCTCTCTGGTCCCGGCCATCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	3585613	3599261	7	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 357 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW85345	1e-126	100.0	BTB (POZ) domai...	Homo sapiens
EAW85347	3.3e-125	100.0	BTB (POZ) domai...	Homo sapiens
Q8IY92	3.3e-125	100.0	BTB/POZ domain-...	Homo sapiens
XP_510772	2.3e-122	98.3	BTB (POZ) domai...	Pan troglodytes
XP_001094220	2.8e-114	93.2	similar to BTB ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AAGCTGAAAAGACACTAAGAC
Primer_r	ACTGAAGCTGAACATGGGTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp