Gene/Protein Characteristic Table for KIAA1970
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00961
Accession No AB075850
Description glutamyl-tRNA synthetase 2, mitochondrial, transcript variant 1
Clone name fk07936
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3110 bp)
Predicted protein sequence (519 aa)
Flexi ORF Clone FXC00961
Source Human fetal brain
Rouge ID mKIAA1970 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3110 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 r 23441551 23476154 10 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 519 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI46121 0 99.8 hypothetical pr...
Homo sapiens
XP_001162700 0 99.0 glutamyl-tRNA s...
Pan troglodytes
AAH40013 2.5e-209 99.4 EARS2 protein [...
Homo sapiens
XP_001094523 1.5e-208 94.2 similar to CG45...
Macaca mulatta
XP_001162661 2.9e-208 98.6 glutamyl-tRNA s...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000924 36 48 PR00987 Glutamyl/glutaminyl-tRNA synthetase
IPR000924 50 61 PR00987 Glutamyl/glutaminyl-tRNA synthetase
IPR000924 65 78 PR00987 Glutamyl/glutaminyl-tRNA synthetase
IPR000924 222 232 PR00987 Glutamyl/glutaminyl-tRNA synthetase
IPR000924 238 246 PR00987 Glutamyl/glutaminyl-tRNA synthetase
HMMPfam IPR000924 32 349 PF00749 Glutamyl/glutaminyl-tRNA synthetase
HMMTigr IPR004527 32 519 TIGR00464 Glutamyl-tRNA synthetase
ScanRegExp IPR001412 39 50 PS00178 Aminoacyl-tRNA synthetase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTGGAAACAATCTCTGACTGC
Primer_r AATGTGTGAGAAACCAGACCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp