KIAA0121

Product ID	ORK00022
Accession No	D50911
Description	vestigial-like family member 4, transcript variant 2
Clone name	fk13569
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3495 bp) Predicted protein sequence (312 aa)
HaloTag ORF Clone	FHC00022
Flexi ORF Clone	FXC00022
Source	Human fetal brain
Rouge ID	mKIAA0121 by Kazusa Mouse cDNA Project
Note	We replaced ha01159, former representative clones for KIAA0121 with fk13569. (2001/10/06)

Length: 3495 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2486 bp
Genome contig ID	gi89161205r_11472544
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAGCCTTAAGAACAATAATAAAGTGCTCTTAAACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATAGTGTACGTGTGCAGTTTCAGCGCCAGGCTGGGTGGGCGGACTCGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	11572544	11736990	5	99.1	Internal No-hit

Length: 312 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001087506	5.9e-109	98.6	similar to vest...	Macaca mulatta
Q14135	3e-108	100.0	Transcription c...	Homo sapiens
EAW64104	6e-108	99.7	vestigial like ...	Homo sapiens
CAH90159	1.8e-107	99.0	hypothetical pr...	Pongo abelii
XP_001492857	6.6e-101	92.8	similar to vest...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	45	293	PD110857	NULL
HMMSmart	IPR006627	228	243	SM00711	Protein of unknown function TDU
HMMSmart	IPR006627	256	271	SM00711	Protein of unknown function TDU

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TAACAGGAAAACCACCCACAG
Primer_r	TCACGGAGCCCCTTCTTAGAG
PCR product length	243 bp
PCR conditions	95 °C15 sec66 °C120 sec30 cycles