Gene/Protein Characteristic Table for KIAA0008
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04790
Accession No D13633
Description discs, large (Drosophila) homolog-associated protein 5
Clone name ha00171s2
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (2852 bp)
Predicted protein sequence (876 aa)
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0008 by Kazusa Mouse cDNA Project
Note We replaced ha00171s1 and ha00171, former representative clones for KIAA0008 with ha00171s2. (2008/8/27,2002/12/27)
Features of the cloned cDNA sequence
Description

Length: 2852 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 221 bp
Genome contig ID gi51511730r_54584601
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTTCAACACAGAATAAAAAATGTACTGTGCCTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCTCTCTTGTTTAAAAGGAATAAGCTTAAGGCTAAGTATACTTATTAGCA
Features of the protein sequence
Description

Length: 876 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q15398 0 100.0 Disks large-ass...
Homo sapiens
BAB97376 0 99.9 hepatoma up-reg...
Homo sapiens
BAF84536 0 99.9 unnamed protein...
Homo sapiens
CAD62583 0 99.6 unnamed protein...
Homo sapiens
XP_509961 0 98.2 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023181 3.7e-07 25.1 KIAA0964
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005026 340 637 PF03359 Guanylate-kinase-associated protein
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 14
Experimental conditions
Panel name Genebridge 4
Primer_f TACGGATTACAAGGTCAAAGG
Primer_r GAACCTGCTTTGCTGCTTGAG
PCR product length 201 (1.4k) bp
PCR conditions 95 °C15 sec62 °C120 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp