KIAA0011

Product ID	ORK01950
Accession No	D13636
Description	general transcription factor IIIC, polypeptide 2, beta 110kDa, transcript variant 1
Clone name	ha00409
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3594 bp) Predicted protein sequence (924 aa)
HaloTag ORF Clone	FHC01950
Flexi ORF Clone	FXC01950
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0011 by Kazusa Mouse cDNA Project

Length: 3594 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	819 bp
Genome contig ID	gi89161199r_27302227
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- AAATCTTCTCTAGATTAAATATCTTCAGTTACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCATTCTTTTACACGTCATGATTTTTGATCCTTCATGATACTGTCACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	27402227	27433124	19	100.0	Perfect prediction

Length: 924 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH20981	99.9	General transcr...	Homo sapiens
Q5RDC3	99.6	General transcr...	Pongo abelii
XP_540125	93.6	similar to gene...	Canis lupus fam...
XP_001502409	92.5	general transcr...	Equus caballus
AAH34369	88.4	Gtf3c2 protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	616	655	PF00400	WD40 repeat
HMMSmart	IPR001680	469	525	SM00320	WD40 repeat
	IPR001680	547	597	SM00320	WD40 repeat
	IPR001680	615	655	SM00320	WD40 repeat
	IPR001680	838	878	SM00320	WD40 repeat
ProfileScan	IPR001680	622	657	PS50082	WD40 repeat
ProfileScan	IPR001680	622	664	PS50294	WD40 repeat
ScanRegExp	IPR001680	584	598	PS00678	WD40 repeat
ScanRegExp	IPR001680	642	656	PS00678	WD40 repeat

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTGGGGGGTGCTGATGGATAC
Primer_r	CTGATTTAGCACCTCTTGTCC
PCR product length	112 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles