KIAA0025

Product ID	ORK00371
Accession No	D14695
Description	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1, transcript variant 1
Clone name	ha00594
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1860 bp) Predicted protein sequence (422 aa)
HaloTag ORF Clone	FHC00371
Flexi ORF Clone	FXC00371
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0025 by Kazusa Mouse cDNA Project

Length: 1860 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	591 bp
Genome contig ID	gi51511732f_55423565
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TTCTGTTCAATAAAGTTTTACTATGAATGACCCTG
Flanking genome sequence (111731 - 111780)	----+--------+--------+--------+--------+----* GCAGAGACTCCTGTCATCCTAGCAGTTTACTCTGCGTTTGTTGTATCTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	55523565	55535294	8	99.5	Perfect prediction

Length: 422 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW82893	2.9e-163	99.8	homocysteine-in...	Homo sapiens
BAF84254	2.1e-151	99.7	unnamed protein...	Homo sapiens
BAD96953	2.1e-151	99.7	homocysteine-in...	Homo sapiens
BAF84777	2.4e-151	99.7	unnamed protein...	Homo sapiens
NP_001010989	1.4e-150	99.7	homocysteine-in...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000626	46	120	PF00240	Ubiquitin
HMMSmart	IPR000626	41	118	SM00213	Ubiquitin
ProfileScan	IPR000626	41	103	PS50053	Ubiquitin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	316	SSLSRFLMVMGATVVMYLHHVGW	338	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GGCTTTGACAGGAATGGACT
Primer_r	ATTTGTATCACGGCTTCACG
PCR product length	147 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles