Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00372 |
---|---|
Accession No | D14812 |
Description | mortality factor 4 like 2, transcript variant 2 |
Clone name | ha00640 |
Vector information | |
cDNA sequence | DNA sequence (1826 bp) Predicted protein sequence (288 aa) |
HaloTag ORF Clone |
FHC00372
|
Flexi ORF Clone | FXC00372 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0026
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 654 bp |
---|---|
Genome contig ID | gi89161218r_102717089 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Panel name | Stanford G3 |
---|---|
Primer_f | CCTCCTCAGGAAAGAAGACA |
Primer_r | GCTGAGGTGCTTCGCTGGTA |
PCR product length | 180 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |