KIAA0105

Product ID	ORK07372
Accession No	D14661
Description	Wilms tumor 1 associated protein
Clone name	ha00682
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1622 bp) Predicted protein sequence (192 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0105 by Kazusa Mouse cDNA Project

Length: 1622 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1042 bp
Genome contig ID	gi89161210f_159968610
PolyA signal sequence (ATTAAA,-14)	+--------+--------+----*----+---- GTATTGCACTCTTGATATTAAATTAAATGTGCCTT
Flanking genome sequence (121829 - 121878)	----+--------+--------+--------+--------+----* GAAATAGTTGGTTTTTTTTTTTTTTTAAGTTCAAAGAATATTATGATGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	160068610	160090437	6	100.0	Perfect prediction
Ensembl gnome browser	6	r	51381790	51383302	1	96.0	Terminal No-hit

Length: 192 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL02022	2.7e-50	86.1	mCG16685, isofo...	Mus musculus
XP_001509735	5.4e-50	100.0	similar to Wilm...	Ornithorhynchus...
XP_001150391	9.1e-50	97.5	similar to puta...	Pan troglodytes
EDL02020	1.1e-49	86.0	mCG16685, isofo...	Mus musculus
EAW47628	2.7e-49	100.0	Wilms tumor 1 a...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 6

Experimental conditions

Panel name	Stanford G3
Primer_f	ACCTCAAGCAAGTCCAGCAGC
Primer_r	AAGCAAGGGGAAGGGGAAAAG
PCR product length	353 bp
PCR conditions	95 °C15 sec68 °C120 sec32 cycles