KIAA0101

Product ID	ORK01958
Accession No	D14657
Description	KIAA0101, transcript variant 1
Clone name	ha00771
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (836 bp) Predicted protein sequence (130 aa)
HaloTag ORF Clone	FHC01958
Flexi ORF Clone	FXC01958
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0101 by Kazusa Mouse cDNA Project

Length: 836 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	439 bp
Genome contig ID	gi51511731r_62344843
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TAGATTTTTGCACATTAAAAAATTCAGTATTAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACATTACTTATTCTACCCTCTTTTTTGGCAAGGAGGACAAATACGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	62444843	62460684	4	100.0	Perfect prediction

Length: 130 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL26108	4.6e-38	83.1	mCG131663, isof...	Mus musculus
Q6RIA2	6.8e-37	87.4	PCNA-associated...	Rattus norvegicus
EAW77683	1.3e-36	95.1	hCG2039386, iso...	Homo sapiens
EAW77680	4.7e-36	90.8	hCG2039386, iso...	Homo sapiens
Q9CQX4	7.4e-36	84.7	PCNA-associated...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	20	130	PD072652	NULL

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 15

Experimental conditions

Panel name	Genebridge 4
Primer_f	TCAGTTCGTTCTCTCCTCTCC
Primer_r	TAGTGGCAGAGGTGGAAGAAC
PCR product length	138 (0.4k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles