KIAA0081

Product ID	ORK00399
Accession No	D42039
Description	mesoderm development candidate 2, transcript variant 1
Clone name	ha01009s1
Vector information	The cDNA fragment was originally inserted at the EcoRV-NotI ... The cDNA fragment was originally inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) without using any linker or adapter and a RT-PCR product (1-279) was subcloned upstream of the cDNA (280-4174). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA C-5' end of cDNA.
cDNA sequence	DNA sequence (4174 bp) Predicted protein sequence (235 aa)
HaloTag ORF Clone	FHC00399
Flexi ORF Clone	FXC00399
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0081 by Kazusa Mouse cDNA Project
Note	We replaced ha01009, former representative clones for KIAA0081 with ha01009s1. (2002/5/10)

Length: 4174 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3466 bp
Genome contig ID	gi51511731r_78955150
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- GATCTAATAAATTTGGATGATATCTTTTGACTATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTATGAAACCTGTATCAGATATACACATCTTTCCTTCTTCATCCTCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	79055150	79069190	3	99.1	Perfect prediction

Length: 235 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14696	3.7e-89	100.0	Mesoderm develo...	Homo sapiens
BAE87150	5.3e-86	97.0	unnamed protein...	Macaca fascicularis
XP_001928898	2.6e-77	88.0	similar to Meso...	Sus scrofa
Q3T0U1	4.5e-76	86.8	Mesoderm develo...	Bos taurus
BAC27617	2.5e-67	83.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	11	AVVLLCASDLLLLLLLLPPPG	31	PRIMARY	21

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACTGAGGGGAGCCAACATAAG
Primer_r	TTAGTAGAGACAGGGCTTCAC
PCR product length	198 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles