Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00405 |
---|---|
Accession No | D42053 |
Description | membrane-bound transcription factor peptidase, site 1 |
Clone name | ha01032 |
Vector information | |
cDNA sequence | DNA sequence (4338 bp) Predicted protein sequence (1058 aa) |
HaloTag ORF Clone |
FHC00405
|
Flexi ORF Clone | FXC00405 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0091
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 683 bp |
---|---|
Genome contig ID | gi51511732r_82544872 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 82644872 | 82708012 | 23 | 99.9 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000209 | 215 | 234 | PR00723 | Peptidase S8 and S53 |
IPR000209 | 251 | 264 | PR00723 | Peptidase S8 and S53 | |
IPR000209 | 417 | 433 | PR00723 | Peptidase S8 and S53 | |
HMMPfam | IPR000209 | 198 | 470 | PF00082 | Peptidase S8 and S53 |
ScanRegExp | IPR000209 | 255 | 265 | PS00137 | Peptidase S8 and S53 |
IPR000209 | 418 | 428 | PS00138 | Peptidase S8 and S53 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2 | YSLVTMKLVNIWLLLLVVLLCG | 23 | PRIMARY | 22 | 2 | 52 | EFSSTVVEYEYIVAFNGYFTAK | 73 | SECONDARY | 22 | 3 | 1006 | QTIPVFAFLGAMVVLAFFVVQIN | 1028 | PRIMARY | 23 |
---|
Panel name | Stanford G3 |
---|---|
Primer_f | ACCACAACCTCCGCTATCCAC |
Primer_r | GAAGATGACGAGCGAGAGGCC |
PCR product length | 287 (2.0k) bp |
PCR conditions | 95 °C15 sec66 °C120 sec30 cycles |