KIAA0030

Product ID	ORK01953
Accession No	D21063
Description	minichromosome maintenance complex component 2, transcript variant 1
Clone name	ha01140
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3406 bp) Predicted protein sequence (914 aa)
HaloTag ORF Clone	FHC01953
Flexi ORF Clone	FXC01953
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0030 by Kazusa Mouse cDNA Project

Length: 3406 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	660 bp
Genome contig ID	gi89161205f_128700850
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- GTAGTTTTAATTTTTAATAAAGTTGAATAAAATAT
Flanking genome sequence (123118 - 123167)	----+--------+--------+--------+--------+----* AAACGCTGGTATCTGTTGGCTTCCATTCCGCTTTAGTAAGTAACCTGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	128799969	128823966	16	99.9	Perfect prediction

Length: 914 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P49736	100.0	DNA replication...	Homo sapiens
AAH06165	99.9	Minichromosome ...	Homo sapiens
AAH17258	99.9	Minichromosome ...	Homo sapiens
XP_001136645	99.9	minichromosome ...	Pan troglodytes
AAP88736	100.0	MCM2 minichromo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001208	465	516	PD001041	MCM
FPrintScan	IPR008045	313	330	PR01658	MCM protein 2
	IPR008045	336	348	PR01658	MCM protein 2
	IPR008045	371	385	PR01658	MCM protein 2
	IPR008045	432	443	PR01658	MCM protein 2
	IPR008045	447	458	PR01658	MCM protein 2
	IPR001208	524	539	PR01657	MCM
	IPR001208	584	598	PR01657	MCM
	IPR001208	612	625	PR01657	MCM
	IPR001208	636	648	PR01657	MCM
	IPR001208	663	671	PR01657	MCM
HMMPfam	IPR001208	470	813	PF00493	MCM
HMMSmart	IPR001208	300	813	SM00350	MCM
ProfileScan	IPR001208	483	689	PS50051	MCM
ScanRegExp	IPR001208	592	600	PS00847	MCM

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TGGCATGGAAAGGGACTA
Primer_r	CAATCATCTCCTCGTCCT
PCR product length	280 bp
PCR conditions	95 °C15 sec54 °C60 sec30 cycles