KIAA0075

Product ID	ORK04850
Accession No	D38550
Description	E2F transcription factor 3
Clone name	ha01209
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3805 bp) Predicted protein sequence (174 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0075 by Kazusa Mouse cDNA Project

Length: 3805 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3280 bp
Genome contig ID	gi89161210f_20494899
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATGGTAAAGGATCAATAAAATGATTTTTTTTAAG
Flanking genome sequence (107023 - 107072)	----+--------+--------+--------+--------+----* AGTTCAGGCTTGTGGATGGGTTTTCTTTAATATTATCTTGTGCTCCTCTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	20594899	20601920	3	99.1	Terminal No-hit

Length: 174 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW55422	1.4e-68	100.0	E2F transcripti...	Homo sapiens
AAI14555	1.5e-68	100.0	E2F3 protein [H...	Homo sapiens
CAH18140	2.1e-68	100.0	hypothetical pr...	Homo sapiens
EAW55421	2.1e-68	100.0	E2F transcripti...	Homo sapiens
O00716	2.8e-68	100.0	Transcription f...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 6

Experimental conditions

Panel name	Stanford G3
Primer_f	TTATGACTGCGTGAGCCTTAG
Primer_r	AGAGCCACAACAAAGAACAGA
PCR product length	271 bp
PCR conditions	95 °C15 sec62 °C120 sec32 cycles