KIAA0066

Product ID	ORK01052
Accession No	D31886
Description	RAB3 GTPase activating protein subunit 1 (catalytic), transcript variant 2
Clone name	ha01217
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3635 bp) Predicted protein sequence (981 aa)
HaloTag ORF Clone	FHC01052
Flexi ORF Clone	FXC01052
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0066 by Kazusa Mouse cDNA Project

Length: 3635 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	687 bp
Genome contig ID	gi89161199f_135426468
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGTCACTGCAAATTAGTTTTATATCTGTCATGTG
Flanking genome sequence (217042 - 217091)	----+--------+--------+--------+--------+----* AGATTTGTCTTACTTATTTTTCTTTTGGTTGCCATGGAAGTTATGGCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	135526346	135643508	24	100.0	Perfect prediction

Length: 981 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_525929	99.7	RAB3 GTPase-act...	Pan troglodytes
XP_001153005	99.0	RAB3 GTPase-act...	Pan troglodytes
XP_001152623	99.7	RAB3 GTPase-act...	Pan troglodytes
XP_001096972	97.8	similar to RAB3...	Macaca mulatta
XP_001489520	95.9	similar to RAB3...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 2

Experimental conditions

Panel name	Genebridge 4
Primer_f	TGAGGGGAAAAAGACAAGTGC
Primer_r	CCTACCTCTCCCTTTTCCTTA
PCR product length	123 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles