KIAA0072

Product ID	ORK01956
Accession No	D31889
Description	proteasome 26S subunit, non-ATPase 5, transcript variant 1
Clone name	ha01357
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3346 bp) Predicted protein sequence (503 aa)
HaloTag ORF Clone	FHC01956
Flexi ORF Clone	FXC01956
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0072 by Kazusa Mouse cDNA Project

Length: 3346 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1832 bp
Genome contig ID	gi89161216r_122518172
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTTTTTTAGATTGAATAAAATTTGTAAATCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTCATTTCATAAGTAAACACCTGTTGACTGCCTATTATGTTCTTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	122618172	122645007	10	99.4	Perfect prediction

Length: 503 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q16401	1.1e-203	100.0	26S proteasome ...	Homo sapiens
BAF83740	2.7e-203	99.8	unnamed protein...	Homo sapiens
XP_520224	2.7e-203	99.8	proteasome 26S ...	Pan troglodytes
Q5IFJ8	1.6e-200	98.2	26S proteasome ...	Macaca fascicularis
Q0P5A6	8.3e-193	93.8	26S proteasome ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 9

Experimental conditions

Panel name	Genebridge 4
Primer_f	ATGAACTTTGCCCTGTGGTGG
Primer_r	CCCTTCTGTTCTGAGTCTGTT
PCR product length	181 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles