KIAA0074

Product ID	ORK00396
Accession No	D38553
Description	non-SMC condensin I complex, subunit H, transcript variant 1
Clone name	ha01438
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2726 bp) Predicted protein sequence (747 aa)
HaloTag ORF Clone	FHC00396
Flexi ORF Clone	FXC00396
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0074 by Kazusa Mouse cDNA Project

Length: 2726 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	481 bp
Genome contig ID	gi89161199f_96271103
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TATAGAATGCTCAAAAATAAAATTCTTAATAATAG
Flanking genome sequence (132196 - 132245)	----+--------+--------+--------+--------+----* AACTGGCAAAATATTTGAGTGTCCACTAGATGAGTATCAGACCTAGTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	96365276	96403297	18	100.0	Perfect prediction

Length: 747 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA07556	100.0	HCAP-H [Homo sa...	Homo sapiens
Q15003	100.0	Condensin compl...	Homo sapiens
AAH24211	99.9	Non-SMC condens...	Homo sapiens
BAF83742	99.7	unnamed protein...	Homo sapiens
XP_001148661	99.3	barren isoform ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008418	33	746	PF05786	Barren

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 2

Experimental conditions

Panel name	Stanford G3
Primer_f	GAAGTGGCTGACGAGAAGATG
Primer_r	CACAAGAACATCAGAGAGGTC
PCR product length	174 (4.0k) bp
PCR conditions	95 °C15 sec64 °C300 sec30 cycles