Order Kazusa clone(s) from : ![]() |
Product ID | ORK00009 |
---|---|
Accession No | D38552 |
Description | peptidylprolyl isomerase domain and WD repeat containing 1, transcript variant 1 |
Clone name | ha01539 |
Vector information | |
cDNA sequence | DNA sequence (2091 bp) Predicted protein sequence (645 aa) |
HaloTag ORF Clone |
FHC00009
![]() |
Flexi ORF Clone | FXC00009 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 152 bp |
---|---|
Genome contig ID | gi51511721f_64794896 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (124237 - 124286) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 64894896 | 64919131 | 11 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002130 | 506 | 521 | PR00153 | Peptidyl-prolyl cis-trans isomerase |
IPR002130 | 532 | 544 | PR00153 | Peptidyl-prolyl cis-trans isomerase | |
IPR002130 | 575 | 590 | PR00153 | Peptidyl-prolyl cis-trans isomerase | |
IPR002130 | 590 | 602 | PR00153 | Peptidyl-prolyl cis-trans isomerase | |
IPR002130 | 603 | 618 | PR00153 | Peptidyl-prolyl cis-trans isomerase | |
HMMPfam | IPR001680 | 88 | 116 | PF00400 | WD40 repeat |
IPR001680 | 122 | 160 | PF00400 | WD40 repeat | |
IPR001680 | 283 | 307 | PF00400 | WD40 repeat | |
IPR002130 | 492 | 645 | PF00160 | Peptidyl-prolyl cis-trans isomerase | |
HMMSmart | IPR001680 | 79 | 116 | SM00320 | WD40 repeat |
IPR001680 | 121 | 160 | SM00320 | WD40 repeat | |
IPR001680 | 210 | 250 | SM00320 | WD40 repeat | |
IPR001680 | 268 | 307 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 85 | 169 | PS50294 | WD40 repeat |
IPR001680 | 128 | 169 | PS50082 | WD40 repeat | |
IPR002130 | 489 | 644 | PS50072 | Peptidyl-prolyl cis-trans isomerase |
Panel name | Genebridge 4 |
---|---|
Primer_f | AGTGGTAGCGATTTTCAGCAG |
Primer_r | CTCATCGTTCTCCTGGGACAC |
PCR product length | 120 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |