KIAA0117

Product ID	ORK06607
Accession No	D38491
Description	RNA binding motif protein 34
Clone name	ha01845
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (881 bp) Predicted protein sequence (227 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0117 by Kazusa Mouse cDNA Project

Length: 881 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	197 bp
Genome contig ID	gi89161185r_233282426
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTATTGAGTTTACTTAATAAAATGATACTCTTGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGAAAGCCTGCAATGTACTTTGGAGGGTGGATGGGTGACTTATTTACTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	233382426	233391170	5	100.0	Perfect prediction

Length: 227 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW70007	1.2e-74	100.0	RNA binding mot...	Homo sapiens
P42696	9.1e-72	99.5	RNA-binding pro...	Homo sapiens
XP_001102020	2.5e-70	93.8	RNA binding mot...	Macaca mulatta
AAH29451	5.1e-70	99.5	RNA binding mot...	Homo sapiens
BAF85051	5.8e-70	99.1	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	189	217	PF00076	RNA recognition motif
ProfileScan	IPR000504	187	227	PS50102	RNA recognition motif

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	CCCAGATTCAACCCGTGTACG
Primer_r	GTGTGTTTCTTCTTCGCTTTC
PCR product length	145 (0.4k) bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles