KIAA0039

Product ID	ORK00381
Accession No	D26018
Description	polymerase (DNA-directed), delta 3, accessory subunit, transcript variant 1
Clone name	ha02030
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3430 bp) Predicted protein sequence (491 aa)
HaloTag ORF Clone	FHC00381
Flexi ORF Clone	FXC00381
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0039 by Kazusa Mouse cDNA Project

Length: 3430 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1954 bp
Genome contig ID	gi51511727f_73881277
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACCACATGAGTTAAATAAATTTGAGAAGTTGTTTT
Flanking genome sequence (150138 - 150187)	----+--------+--------+--------+--------+----* AAAACAGTGCTTCAAACTGAGTATCTGATGAGTCTCTTATTTGATGGATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	73981277	74031413	12	99.4	Perfect prediction

Length: 491 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_508641	7.3e-143	98.8	polymerase (DNA...	Pan troglodytes
XP_001082315	7.7e-141	96.7	polymerase (DNA...	Macaca mulatta
Q15054	7.9e-137	100.0	DNA polymerase ...	Homo sapiens
BAH14741	2.1e-136	99.8	unnamed protein...	Homo sapiens
BAG63909	2.1e-136	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 11

Experimental conditions

Panel name	Genebridge 4
Primer_f	TTGGGATTGTGCTGACTTTGG
Primer_r	GACAAATGACCAGAGGCAATG
PCR product length	288 bp
PCR conditions	95 °C15 sec62 °C60 sec35 cycles