Order Kazusa clone(s) from : ![]() |
Product ID | ORK01659 |
---|---|
Accession No | D79999 |
Description | poly (ADP-ribose) polymerase family, member 4 |
Clone name | ha02779s1 |
Vector information | |
cDNA sequence | DNA sequence (5367 bp) Predicted protein sequence (1725 aa) |
Flexi ORF Clone |
FXC01659
![]() |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0177
by Kazusa Mouse cDNA Project
|
Note | We replaced ha02779, former representative clones for KIAA0177 with ha02779s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 187 bp |
---|---|
Genome contig ID | gi51511729r_23793070 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 13 | r | 23893070 | 23975919 | 33 | 99.3 | Perfect prediction |
| 13 | f | 24405137 | 24409126 | 2 | 97.0 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001357 | 2 | 82 | PF00533 | BRCT |
IPR001290 | 379 | 567 | PF00644 | Poly(ADP-ribose) polymerase | |
IPR013694 | 620 | 737 | PF08487 | Vault protein inter-alpha-trypsin | |
IPR002035 | 877 | 1044 | PF00092 | von Willebrand factor | |
HMMSmart | IPR001357 | 4 | 85 | SM00292 | BRCT |
IPR006587 | 608 | 736 | SM00609 | Vault protein inter-alpha-trypsin | |
IPR002035 | 875 | 1038 | SM00327 | von Willebrand factor | |
ProfileScan | IPR001357 | 2 | 95 | PS50172 | BRCT |
IPR004102 | 243 | 371 | PS51060 | Poly(ADP-ribose) polymerase | |
IPR012317 | 370 | 574 | PS51059 | PARP | |
IPR002035 | 877 | 1047 | PS50234 | von Willebrand factor |
Panel name | Genebridge 4 |
---|---|
Primer_f | ATAAGCCCCTGGACATCACAC |
Primer_r | TGTCTTCCTCCTCTGTGGCAC |
PCR product length | 102 (1.4k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |