KIAA0196

Product ID	ORK01963
Accession No	D83780
Description	KIAA0196
Clone name	ha02952
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4103 bp) Predicted protein sequence (1164 aa)
HaloTag ORF Clone	FHC01963
Flexi ORF Clone	FXC01963
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0196 by Kazusa Mouse cDNA Project

Length: 4103 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	350 bp
Genome contig ID	gi51511724r_126005691
PolyA signal sequence (AGTAAA,-20)	+--------+--------+----*----+---- CAACTCCAGATTTTCAGTAAAATAGTATTACTAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCAAAGTCGTCTCGCTTATGATTCAAAAACTGTGTATTCACCCTGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	126105691	126173187	29	99.8	Perfect prediction

Length: 1164 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001498386	98.5	similar to Stru...	Equus caballus
XP_584765	97.9	similar to Stru...	Bos taurus
Q8C2E7	95.8	Strumpellin.	Mus musculus
XP_001370592	95.0	hypothetical pr...	Monodelphis dom...
XP_001511057	92.9	similar to Stru...	Ornithorhynchus...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 8

Experimental conditions

Panel name	Genebridge 4
Primer_f	GGACTGCGGATAGAAGAGGAC
Primer_r	CACTGGGGATGATTAACTGGC
PCR product length	234 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles