Order Kazusa clone(s) from : ![]() |
Product ID | ORK00465 |
---|---|
Accession No | D86972 |
Description | TatD DNase domain containing 2 |
Clone name | ha02987 |
Vector information | |
cDNA sequence | DNA sequence (4689 bp) Predicted protein sequence (777 aa) |
HaloTag ORF Clone |
FHC00465
![]() |
Flexi ORF Clone | FXC00465 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0218
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2005 bp |
---|---|
Genome contig ID | gi89161205f_10165219 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (132683 - 132732) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 10265219 | 10297900 | 9 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | AGTCTCCAAGCCTGTGCCATC |
Primer_r | AGAGGCATTCCCACAGCACAG |
PCR product length | 199 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |