KIAA0218

Product ID	ORK00465
Accession No	D86972
Description	TatD DNase domain containing 2
Clone name	ha02987
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4689 bp) Predicted protein sequence (777 aa)
HaloTag ORF Clone	FHC00465
Flexi ORF Clone	FXC00465
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0218 by Kazusa Mouse cDNA Project

Length: 4689 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2005 bp
Genome contig ID	gi89161205f_10165219
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CTTTTTCTGAAAATAAAGTGATGGATCCTCTAGCC
Flanking genome sequence (132683 - 132732)	----+--------+--------+--------+--------+----* AACCCAGTCTCTCCGTGTTTGTATAGACTTACCTGAGTGATGCAGTGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	10265219	10297900	9	99.3	Perfect prediction

Length: 777 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09663	100.0	TatD DNase doma...	synthetic construct
Q93075	99.9	Putative deoxyr...	Homo sapiens
AAH90935	99.7	TatD DNase doma...	Homo sapiens
BAF82483	99.5	unnamed protein...	Homo sapiens
XP_516276	98.7	TatD DNase doma...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001130	509	776	PF01026	TatD-related deoxyribonuclease
ScanRegExp	IPR001130	511	519	PS01137	TatD-related deoxyribonuclease
	IPR001130	642	652	PS01090	TatD-related deoxyribonuclease
	IPR001130	709	725	PS01091	TatD-related deoxyribonuclease

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AGTCTCCAAGCCTGTGCCATC
Primer_r	AGAGGCATTCCCACAGCACAG
PCR product length	199 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles