KIAA0156

Product ID	ORK00031
Accession No	D63879
Description	squamous cell carcinoma antigen recognized by T cells 3
Clone name	ha03253
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3660 bp) Predicted protein sequence (963 aa)
HaloTag ORF Clone	FHC00031
Flexi ORF Clone	FXC00031
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0156 by Kazusa Mouse cDNA Project

Length: 3660 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	768 bp
Genome contig ID	gi89161190r_107340596
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TCCCCATTTAGCTTTATTAAACTGACGTTCTCTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTTCTTGCTGAATGGTACTCAGATGTGCATTCACATACAGATGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	107440596	107479060	19	99.9	Perfect prediction

Length: 963 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF82898	99.9	unnamed protein...	Homo sapiens
XP_001163755	99.8	squamous cell c...	Pan troglodytes
XP_001102668	98.7	similar to squa...	Macaca mulatta
XP_001163716	99.8	squamous cell c...	Pan troglodytes
XP_001102488	98.7	similar to squa...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	706	777	PF00076	RNA recognition motif
	IPR000504	803	873	PF00076	RNA recognition motif
	IPR008669	942	963	PF05391	Lsm interaction
HMMSmart	IPR003107	126	158	SM00386	RNA-processing protein
	IPR003107	164	195	SM00386	RNA-processing protein
	IPR003107	201	237	SM00386	RNA-processing protein
	IPR003107	324	356	SM00386	RNA-processing protein
	IPR003107	359	391	SM00386	RNA-processing protein
	IPR003107	394	430	SM00386	RNA-processing protein
	IPR003107	487	520	SM00386	RNA-processing protein
	IPR000504	705	778	SM00360	RNA recognition motif
	IPR000504	802	874	SM00360	RNA recognition motif
ProfileScan	IPR000504	704	782	PS50102	RNA recognition motif
ProfileScan	IPR000504	801	878	PS50102	RNA recognition motif

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GCTAGGACAAGGAGGAAGGTG
Primer_r	TACTCATCCCCATCGCTCTCG
PCR product length	116 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles