Gene/Protein Characteristic Table for KIAA0133
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07735
Accession No D50923
Description URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Clone name ha03502s1
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (5613 bp)
Predicted protein sequence (1527 aa)
Flexi ORF Clone FXC07735
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0133 by Kazusa Mouse cDNA Project
Note We replaced ha03502, former representative clones for KIAA0133 with ha03502s1. (2008/8/27)
Features of the cloned cDNA sequence
Description

Length: 5613 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 902 bp
Genome contig ID gi89161185f_227728604
PolyA signal sequence
(CATAAA,-23)
+----*----+----*----+----*----+----
GCTAAATTGGATCATAAATGCATTTTTTTAAAGTT
Flanking genome sequence
(133967 - 134016)
----+----*----+----*----+----*----+----*----+----*
ACCTTTTTTCCTGTGTAATATTTTAAGTAACTCTGGGTCAGTGAAAACAT
Features of the protein sequence
Description

Length: 1527 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAF83702 0 99.8 unnamed protein...
Homo sapiens
XP_001083545 0 93.5 hypothetical pr...
Macaca mulatta
AAI48097 0 73.7 LOC514623 prote...
Bos taurus
NP_001025047 0 71.5 URB2 ribosome b...
Mus musculus
EDL11764 0 70.0 cDNA sequence A...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name Stanford G3
Primer_f TGCCTGCTCCTCCTGTGTTAG
Primer_r AAGATACTCCAAGGTGACAAC
PCR product length 214 bp
PCR conditions 95 °C15 sec62 °C120 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp