Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00416 |
---|---|
Accession No | D50912 |
Description | RNA binding motif protein 10, transcript variant 1 |
Clone name | ha03733 |
Vector information | |
cDNA sequence | DNA sequence (3244 bp) Predicted protein sequence (1010 aa) |
HaloTag ORF Clone |
FHC00416
|
Flexi ORF Clone | FXC00416 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0122
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 210 bp |
---|---|
Genome contig ID | gi89161218f_46789710 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (141444 - 141493) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000504 | 212 | 277 | PF00076 | RNA recognition motif |
IPR001876 | 293 | 323 | PF00641 | Zinc finger | |
IPR000504 | 383 | 459 | PF00076 | RNA recognition motif | |
IPR000467 | 938 | 982 | PF01585 | D111/G-patch | |
HMMSmart | IPR000504 | 211 | 286 | SM00360 | RNA recognition motif |
IPR001876 | 296 | 320 | SM00547 | Zinc finger | |
IPR000504 | 382 | 460 | SM00360 | RNA recognition motif | |
IPR000467 | 936 | 982 | SM00443 | D111/G-patch | |
ProfileScan | IPR000504 | 210 | 290 | PS50102 | RNA recognition motif |
IPR001876 | 293 | 323 | PS50199 | Zinc finger | |
IPR000504 | 381 | 464 | PS50102 | RNA recognition motif | |
IPR007087 | 839 | 869 | PS50157 | Zinc finger | |
IPR000467 | 938 | 984 | PS50174 | D111/G-patch | |
ScanRegExp | IPR001876 | 298 | 317 | PS01358 | Zinc finger |
Panel name | Genebridge 4 |
---|---|
Primer_f | GAGCCCACTTGTCAGAAAACG |
Primer_r | ACTTCCTCCTCTTGGGCTCTG |
PCR product length | 135 (0.4k) bp |
PCR conditions | 95 °C15 sec70 °C120 sec30 cycles |