KIAA0138

Product ID	ORK01961
Accession No	D50928
Description	scaffold attachment factor B2
Clone name	ha03743
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3233 bp) Predicted protein sequence (962 aa)
HaloTag ORF Clone	FHC01961
Flexi ORF Clone	FXC01961
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0138 by Kazusa Mouse cDNA Project

Length: 3233 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	335 bp
Genome contig ID	gi42406306r_5438011
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CATTCCATTTTCCATTAATAAAGTTTACCATTCGC
Flanking genome sequence (235752 - 235703)	----+--------+--------+--------+--------+----* CCGGGGTTGCGGGGGGGGGGGTCTTGATAAACCACCGTTTGCTGGGTCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	5538010	5573762	21	99.9	Terminal No-hit

Length: 962 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_512297	0	99.7	scaffold attach...	Pan troglodytes
XP_001084042	0	98.6	scaffold attach...	Macaca mulatta
XP_533945	0	88.9	similar to Scaf...	Canis lupus fam...
XP_585928	5.7e-216	82.9	similar to Scaf...	Bos taurus
EAW69165	2e-215	99.1	scaffold attach...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003034	39	73	PF02037	DNA-binding SAP
HMMPfam	IPR000504	418	489	PF00076	RNA recognition motif
HMMSmart	IPR003034	39	73	SM00513	DNA-binding SAP
HMMSmart	IPR000504	417	490	SM00360	RNA recognition motif
ProfileScan	IPR003034	39	73	PS50800	DNA-binding SAP
ProfileScan	IPR000504	416	494	PS50102	RNA recognition motif

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AAGACGGGAACGCGACGATGG
Primer_r	GTCCAGGTTCCGCTTCTTCAG
PCR product length	161 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles