KIAA0126

Product ID	ORK00418
Accession No	D50916
Description	ubiquitination factor E4A, transcript variant 1
Clone name	ha03786
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6060 bp) Predicted protein sequence (1075 aa)
HaloTag ORF Clone	FHC00418
Flexi ORF Clone	FXC00418
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0126 by Kazusa Mouse cDNA Project

Length: 6060 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2766 bp
Genome contig ID	gi51511727f_117640964
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCAAAACTTGTATTTAATAAATGAACATCTGACTT
Flanking genome sequence (134170 - 134219)	----+--------+--------+--------+--------+----* ACAACCTTTGTTATCACTTTATTCCAGTATTAAAAGCTAGTGGCAGTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	117735569	117775132	20	99.5	Perfect prediction

Length: 1075 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09613	100.0	ubiquitin conju...	synthetic construct
EAW67371	99.9	hCG2033105, iso...	Homo sapiens
XP_508791	99.6	ubiquitination ...	Pan troglodytes
Q14139	99.2	Ubiquitin conju...	Homo sapiens
XP_001161169	98.9	ubiquitination ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014584	1e-40	27.4	KIAA0684

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003613	996	1070	PF04564	U box
HMMSmart	IPR003613	1000	1063	SM00504	U box

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TATCATCCTCCTTTCCCTCTC
Primer_r	GCCTTCTGAGTTTTTGTGCCC
PCR product length	175 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles