Gene/Protein Characteristic Table for KIAA0160
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07031
Accession No D63881
Description SUZ12 polycomb repressive complex 2 subunit
Clone name ha03912s1
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (4441 bp)
Predicted protein sequence (803 aa)
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0160 by Kazusa Mouse cDNA Project
Note We replaced ha03912, former representative clones for KIAA0160 with ha03912s1. (2008/8/27)
Features of the cloned cDNA sequence
Description

Length: 4441 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2027 bp
Genome contig ID gi51511734f_27188278
PolyA signal sequence
(CATAAA,-18)
+----*----+----*----+----*----+----
AATCAAATGATTTTGTACATAAAGTTCAATAATAT
Flanking genome sequence
(163886 - 163935)
----+----*----+----*----+----*----+----*----+----*
AAAAGCTGTATTCTGTTTTGGGGTTTTTTTGTTATTATGCATTGTTAACA
Features of the protein sequence
Description

Length: 803 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EDL15617 0 94.0 suppressor of z...
Mus musculus
Q15022 0 100.0 Polycomb protei...
Homo sapiens
BAF82703 0 99.7 unnamed protein...
Homo sapiens
XP_001174690 0 99.5 joined to JAZF1...
Pan troglodytes
XP_582605 0 99.2 similar to Poly...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR007087 514 535 PS00028 Zinc finger
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name Stanford G3
Primer_f TACTGGCACATTAACAAGCAC
Primer_r ATCCAGAGGCAAAAATCAGAG
PCR product length 480 bp
PCR conditions 95 °C15 sec62 °C60 sec32 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp