KIAA0127

Product ID	ORK00419
Accession No	D50917
Description	SERTA domain containing 2
Clone name	ha03921
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5544 bp) Predicted protein sequence (315 aa)
HaloTag ORF Clone	FHC00419
Flexi ORF Clone	FXC00419
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0127 by Kazusa Mouse cDNA Project

Length: 5544 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4302 bp
Genome contig ID	gi89161199r_64612260
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAGTTTTATATTATACAATAAACAGTTAAAAGATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGAGGCATGCTTGCAGTTTTCTTTTGATGGGAGCTCAATCAGCTTATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	64712260	64734550	2	99.0	Perfect prediction

Length: 315 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14140	3.2e-114	100.0	SERTA domain-co...	Homo sapiens
XP_515728	3.7e-113	99.0	SERTA domain co...	Pan troglodytes
CAH90183	3.8e-112	98.4	hypothetical pr...	Pongo abelii
XP_001088920	4.5e-111	97.1	SERTA domain co...	Macaca mulatta
XP_001494703	2.2e-99	88.9	similar to SERT...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009263	41	78	PF06031	SERTA
ProfileScan	IPR009263	34	81	PS51053	SERTA

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TGGACTTCTTTTGGGGATAAC
Primer_r	TCTCAGGTCTGTGGGGGAAAG
PCR product length	165 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles