KIAA0162

Product ID	ORK07029
Accession No	D79984
Description	suppressor of Ty 6 homolog (S. cerevisiae)
Clone name	ha03982
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5876 bp) Predicted protein sequence (1730 aa)
HaloTag ORF Clone	FHC07029
Flexi ORF Clone	FXC07029
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0162 by Kazusa Mouse cDNA Project

Length: 5876 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	605 bp
Genome contig ID	gi51511734f_23913429
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCTGCCTGTCATTTGAATAAACAGTGTTTCTATTG
Flanking genome sequence (139948 - 139997)	----+--------+--------+--------+--------+----* AGCTCTTGCCAAAGCCTCTCTCTCCAACTCTCCAGCTCTTTGAGGGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	24013429	24053375	37	99.9	Perfect prediction

Length: 1730 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7KZ85	100.0	Transcription e...	Homo sapiens
XP_001142885	99.8	similar to puta...	Pan troglodytes
XP_537747	99.7	similar to supp...	Canis lupus fam...
XP_001504206	99.5	suppressor of T...	Equus caballus
XP_873999	99.0	similar to supp...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003029	1235	1286	PF00575	S1
HMMPfam	IPR000980	1339	1419	PF00017	SH2 motif
HMMSmart	IPR006641	783	898	SM00732	Resolvase
	IPR003029	1225	1286	SM00316	S1
	IPR000980	1336	1425	SM00252	SH2 motif
ProfileScan	IPR003029	1231	1286	PS50126	S1
ProfileScan	IPR000980	1329	1435	PS50001	SH2 motif

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TTATTCAGTTTGGGGCAGGAG
Primer_r	TCAAATGACAGGCAGGAAGCG
PCR product length	171 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles