KIAA0220

Product ID	ORK05585
Accession No	D86974
Description	Homo sapiens mRNA for KIAA0220 gene, partial cds.
Clone name	ha04626
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5471 bp) Predicted protein sequence (553 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0220 by Kazusa Mouse cDNA Project

Length: 5471 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	128 bp
Genome contig ID	gi51511732r_21220978
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAAACTAACAAAGAATAAATAAATAATATAAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATAAATACTGCAGTCCTTATGTTATTGCTTTGTTTCGATATCTGGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	21320978	21377463	24	99.3	Terminal No-hit
Ensembl gnome browser	16	f	22399084	22455335	25	99.1	Terminal No-hit
Ensembl gnome browser	16	r	21753412	21809706	26	98.8	Terminal No-hit
Ensembl gnome browser	16	r	29402383	29459387	25	98.3	Both No-hit
Ensembl gnome browser	16	r	29300140	29357622	27	97.2	Both No-hit

Length: 553 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG61851	100.0	unnamed protein...	Homo sapiens
Q5BKU6	100.0	Putative unchar...	Homo sapiens
AAH90929	100.0	LOC641298 prote...	Homo sapiens
XP_001151793	96.0	similar to PI-3...	Pan troglodytes
XP_001151857	96.0	similar to PI-3...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CGGAGGTTGAGCTGAGAAGAG
Primer_r	TGTTAGTTTTTGGAGTGTGGG
PCR product length	118 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles