KIAA0251

Product ID	ORK00478
Accession No	D87438
Description	pyridoxal-dependent decarboxylase domain containing 1, transcript variant 1
Clone name	ha07028
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3875 bp) Predicted protein sequence (820 aa)
HaloTag ORF Clone	FHC00478
Flexi ORF Clone	FXC00478
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0251 by Kazusa Mouse cDNA Project

Length: 3875 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1411 bp
Genome contig ID	gi51511732f_14876461
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAATGTTGGTTTCAATAAAGGTTCTTGAAATTGTT
Flanking genome sequence (162585 - 162634)	----+--------+--------+--------+--------+----* ACCAGTGAATTCAGTTTATAAATCTTATTACAAAAGACTTACCCACGTAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	14976461	15039044	23	100.0	Perfect prediction

Length: 820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6P996	100.0	Pyridoxal-depen...	Homo sapiens
AAH60871	99.9	Pyridoxal-depen...	Homo sapiens
XP_001109439	95.1	similar to CG14...	Macaca mulatta
BAG58179	99.7	unnamed protein...	Homo sapiens
XP_547116	91.0	similar to CG14...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002129	246	301	PF00282	Pyridoxal phosphate-dependent decarboxylase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CACTGGGTTTCTGGACTGTAG
Primer_r	GACTGTTTAATCATCTGCACC
PCR product length	142 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles