KIAA0252

Product ID	ORK00479
Accession No	D87440
Description	Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Clone name	ha07048s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4404 bp) Predicted protein sequence (702 aa)
HaloTag ORF Clone	FHC00479
Flexi ORF Clone	FXC00479
Source	Myeloblast cell line (KG-1)
Note	We replaced ha07048, former representative clones for KIAA0252 with ha07048s1. (2002/5/10)

Length: 4404 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2293 bp
Genome contig ID	gi51511731f_39396653
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTATGGCTGTGTAATAAAATTTTTATTAAAACTGC
Flanking genome sequence (165819 - 165868)	----+--------+--------+--------+--------+----* ATCACACTGTAGCCACTTTGCCACCACCTCCCCACATGTAGCCGCTGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	39496628	39562470	18	99.5	Perfect prediction

Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_055953	3.4e-189	100.0	Paf1/RNA polyme...	Homo sapiens
XP_001100507	7e-189	100.0	similar to Paf1...	Macaca mulatta
XP_544630	1.2e-187	99.3	similar to Paf1...	Canis lupus fam...
CAM18078	7.5e-186	98.1	Rtf1 Paf1/RNA p...	Mus musculus
Q92541	3.3e-180	100.0	RNA polymerase-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004343	349	454	PF03126	Plus-3
HMMSmart	IPR004343	345	453	SM00719	Plus-3

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GGCAAAGGAGTGTGATGGAC
Primer_r	GTCCAGGCAATGTTAACAGTC
PCR product length	118 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles