Order Kazusa clone(s) from : ![]() |
Product ID | ORK00479 |
---|---|
Accession No | D87440 |
Description | Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) |
Clone name | ha07048s1 |
Vector information | |
cDNA sequence | DNA sequence (4404 bp) Predicted protein sequence (702 aa) |
Flexi ORF Clone | FXC00479 |
Source | Myeloblast cell line (KG-1) |
Note | We replaced ha07048, former representative clones for KIAA0252 with ha07048s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2293 bp |
---|---|
Genome contig ID | gi51511731f_39396653 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (165819 - 165868) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 39496628 | 39562470 | 18 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | GGCAAAGGAGTGTGATGGAC |
Primer_r | GTCCAGGCAATGTTAACAGTC |
PCR product length | 118 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |