KIAA0448

Product ID	ORK00540
Accession No	AB007917
Description	heparan sulfate 2-O-sulfotransferase 1, transcript variant 1
Clone name	hg00135
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6632 bp) Predicted protein sequence (362 aa)
HaloTag ORF Clone	FHC00540
Flexi ORF Clone	FXC00540
Source	Human adult brain
Rouge ID	mKIAA0448 by Kazusa Mouse cDNA Project

Length: 6632 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5279 bp
Genome contig ID	gi89161185f_87053026
PolyA signal sequence (TATAAA,-7)	+--------+--------+----*----+---- GGTTTTGTCATTTCATAAATGATATTTTTATAAAT
Flanking genome sequence (295228 - 295277)	----+--------+--------+--------+--------+----* ATTTTTGAATGACTGTACTTTTTACTGATTATCTTAATACCGCCTCACTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	87153026	87348252	7	99.2	Perfect prediction

Length: 362 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7LGA3	2.8e-157	100.0	Heparan sulfate...	Homo sapiens
XP_001109871	3.3e-157	99.7	heparan sulfate...	Macaca mulatta
Q5R621	5.3e-157	99.7	Heparan sulfate...	Pongo abelii
BAG51177	1.6e-156	99.7	unnamed protein...	Homo sapiens
CAH92556	8e-156	99.4	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007734	15	360	PF05040	Heparan sulphate 2-O-sulphotransferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	PKLQLLAVVAFAVAMLFLENQIQ	38	PRIMARY	23

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	TACATCATGCCCAACCTTTAC
Primer_r	CATTTATGGCACAGTTTGGAC
PCR product length	340 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles