Order Kazusa clone(s) from : ![]() |
Product ID | ORK00540 |
---|---|
Accession No | AB007917 |
Description | heparan sulfate 2-O-sulfotransferase 1, transcript variant 1 |
Clone name | hg00135 |
Vector information | |
cDNA sequence | DNA sequence (6632 bp) Predicted protein sequence (362 aa) |
HaloTag ORF Clone |
FHC00540
![]() |
Flexi ORF Clone | FXC00540 |
Source | Human adult brain |
Rouge ID |
mKIAA0448
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5279 bp |
---|---|
Genome contig ID | gi89161185f_87053026 |
PolyA signal sequence (TATAAA,-7) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (295228 - 295277) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 87153026 | 87348252 | 7 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007734 | 15 | 360 | PF05040 | Heparan sulphate 2-O-sulphotransferase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 16 | PKLQLLAVVAFAVAMLFLENQIQ | 38 | PRIMARY | 23 |
---|
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TACATCATGCCCAACCTTTAC |
Primer_r | CATTTATGGCACAGTTTGGAC |
PCR product length | 340 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |