Gene/Protein Characteristic Table for KIAA0461
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01976
Accession No AB007930
Description pogo transposable element with ZNF domain
Clone name hg00867
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6148 bp)
Predicted protein sequence (1355 aa)
Flexi ORF Clone FXC01976
Source Human adult brain
Rouge ID mKIAA0461 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6148 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1355 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI16808 0 100.0 pogo transposab...
Homo sapiens
EAW53436 0 100.0 pogo transposab...
Homo sapiens
XP_001107678 0 99.5 similar to pogo...
Macaca mulatta
Q7Z3K3 0 96.2 Pogo transposab...
Homo sapiens
CAD97850 0 96.0 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046804 4.2e-27 36.9 KIAA1584
AB040946 1e-05 24.9 KIAA1513
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 439 461 PF00096 Zinc finger
IPR007087 564 586 PF00096 Zinc finger
IPR015175 961 1024 PF09091 Centromere protein B
IPR004875 1062 1218 PF03184 CENP-B protein
HMMSmart IPR015880 439 461 SM00355 Zinc finger
IPR015880 475 498 SM00355 Zinc finger
IPR015880 505 528 SM00355 Zinc finger
IPR015880 535 558 SM00355 Zinc finger
IPR015880 564 586 SM00355 Zinc finger
IPR015880 592 614 SM00355 Zinc finger
IPR015880 716 739 SM00355 Zinc finger
IPR015880 760 785 SM00355 Zinc finger
IPR006600 966 1030 SM00674 Centromere protein B
ProfileScan IPR007087 439 466 PS50157 Zinc finger
IPR007087 475 503 PS50157 Zinc finger
IPR006600 960 1030 PS51253 Centromere protein B
ScanRegExp IPR007087 441 461 PS00028 Zinc finger
IPR007087 477 498 PS00028 Zinc finger
IPR007087 507 528 PS00028 Zinc finger
IPR007087 566 586 PS00028 Zinc finger
IPR007087 594 615 PS00028 Zinc finger
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f TCTACTACTAAGCCATGCAGG
Primer_r AGCTGGGGTTCCTGTCTTCTG
PCR product length 138 bp
PCR conditions 95 °C15 sec68 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp