Gene/Protein Characteristic Table for KIAA0518
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07635
Accession No AB011090
Description MGA, MAX dimerization protein
Clone name hg01059
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4617 bp)
Predicted protein sequence (650 aa)
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4617 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 650 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8IWI9 0 100.0 MAX gene-associ...
Homo sapiens
NP_001074010 0 100.0 MAX gene associ...
Homo sapiens
XP_001150813 0 99.4 similar to MAX-...
Pan troglodytes
XP_510327 0 99.4 similar to MAX-...
Pan troglodytes
EAW92512 0 100.0 hCG1998680, iso...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001092 9 60 PF00010 Basic helix-loop-helix dimerisation region bHLH
HMMSmart IPR001092 14 65 SM00353 Basic helix-loop-helix dimerisation region bHLH
ProfileScan IPR001092 8 60 PS50888 Basic helix-loop-helix dimerisation region bHLH
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GCTTATTATCGCCGGACACAC
Primer_r TGCCTGATCTGTTAGTCCCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 15
Experimental conditions
Panel name GeneBridge 4
Primer_f GCTTATTATCGCCGGACACAC
Primer_r TGCCTGATCTGTTAGTCCCTG
PCR product length 172 (1.2k) bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp