KIAA0406

Product ID	ORK01084
Accession No	AB007866
Description	TELO2 interacting protein 1, transcript variant 1
Clone name	hg01335s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3899 bp) Predicted protein sequence (1095 aa)
HaloTag ORF Clone	FHC01084
Flexi ORF Clone	FXC01084
Source	Human adult brain
Note	We replaced hg01335, former representative clones for KIAA0406 with hg01335s1. (2005/08/06)

Length: 3899 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	434 bp
Genome contig ID	gi51511747r_35944838
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CAAACGGAAATAAAGACACTTCTTGGATGAAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGATCAAAAGCTCACTTTGAAGTTTTTTATTTAAACTGGGTGGTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	36044838	36080962	8	99.8	Terminal No-hit

Length: 1095 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH89980	97.7	hypothetical pr...	Pongo abelii
XP_001090176	97.1	hypothetical pr...	Macaca mulatta
ABG67032	85.2	hypothetical pr...	Bos taurus
AAI26509	85.1	Hypothetical pr...	Bos taurus
AAH53067	85.0	RIKEN cDNA 2610...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CAGGGAGGTGTATGCAGATGG
Primer_r	ATTGTCTGGTGGCTCTAAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 20

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CAGGGAGGTGTATGCAGATGG
Primer_r	ATTGTCTGGTGGCTCTAAGGG
PCR product length	124 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles