KIAA0346

Product ID	ORK00511
Accession No	AB002344
Description	lysine (K)-specific demethylase 6B
Clone name	hg01508s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6698 bp) Predicted protein sequence (1682 aa)
HaloTag ORF Clone	FHC00511
Flexi ORF Clone	FXC00511
Source	Human adult brain
Rouge ID	mKIAA0346 by Kazusa Mouse cDNA Project
Note	We replaced hg01508, former representative clones for KIAA0346 with hg01508s1. (2002/5/10)

Length: 6698 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1268 bp
Genome contig ID	gi51511734f_7583967
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- TTGTGTGAGAATATTAATATTAAAAATAAACGGAG
Flanking genome sequence (114866 - 114915)	----+--------+--------+--------+--------+----* AAAAAAAATCCTGTTTCGCTAACGGCTGGTGGTAGCAGGTTGAGTACCGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	7683953	7698831	22	99.5	Terminal No-hit

Length: 1682 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15054	100.0	Histone demethy...	Homo sapiens
NP_001073893	99.8	jumonji domain ...	Homo sapiens
EAW90127	99.7	hCG2036579, iso...	Homo sapiens
XP_001110616	98.0	similar to jumo...	Macaca mulatta
EAW90126	99.4	hCG2036579, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	1377	1485	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	1339	1502	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	1339	1502	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Primer_f	CGAAAATAGGGGTAGGGTTGG
Primer_r	TTCTCTGGGGCTTTATTTTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CGAAAATAGGGGTAGGGTTGG
Primer_r	TTCTCTGGGGCTTTATTTTCG
PCR product length	151 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles