Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06744 |
---|---|
Accession No | AB007937 |
Description | syndecan 3 |
Clone name | hg01596 |
Vector information | |
cDNA sequence | DNA sequence (6400 bp) Predicted protein sequence (410 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0468
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 3742 bp |
---|---|
Genome contig ID | gi89161185r_31014901 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 31114901 | 31124176 | 3 | 99.0 | Terminal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001050 | 19 | 408 | PF01034 | Syndecan |
HMMSmart | IPR003585 | 376 | 394 | SM00294 | Neurexin/syndecan/glycophorin C |
ScanRegExp | IPR001050 | 377 | 387 | PS00964 | Syndecan |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 19 | RGLGDLILMAIAYLGSSCP | 37 | SECONDARY | 19 | 2 | 352 | EVLVAVIVGGVVGALFAAFLVTL | 374 | PRIMARY | 23 |
---|
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C sec °C sec cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGGCTCTGGGGATGATGACTC |
Primer_r | CCCGTGGGCTTCTCAGAGTTG |
PCR product length | 149 bp |
PCR conditions | 95 °C15 sec68 °C60 sec30 cycles |