KIAA1183

Gene/Protein Characteristic Table for KIAA1183

Order Kazusa clone(s) from :

Product ID	ORK05640
Accession No	AB033009
Description	paraneoplastic Ma antigen family-like 2
Clone name	hg01641a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2752 bp) Predicted protein sequence (345 aa)
Source	Human adult brain

Features of the cloned cDNA sequence

Description

Length: 2752 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1714 bp
Genome contig ID	gi42406306r_51586941
PolyA signal sequence (AGTAAA,-23)	+--------+--------+----*----+---- CCTGGATCCTCCAGTAAAGTGAAATTCAGCACTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCTCTCTGTGCTCTGGGCAGTGGGGCAGGCGGGGTGTGGGAGCGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	51686941	51689686	1	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 345 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9ULN7	1.2e-106	100.0	PNMA-like prote...	Homo sapiens
AAI66688	5.4e-105	99.1	PNMA-like 2 [sy...	synthetic construct
XP_001167965	1.7e-104	98.8	hypothetical pr...	Pan troglodytes
XP_001111896	2.2e-101	96.8	similar to para...	Macaca mulatta
EAW57424	3.7e-86	99.0	hCG1640304 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CCACCTTCATTCATGCCTTCT
Primer_r	GTCTCAGTCAGCTTCTACATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 19

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp