Gene/Protein Characteristic Table for KIAA1184
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00756
Accession No AB033010
Description paroxysmal nonkinesigenic dyskinesia, transcript variant 1
Clone name hg01696a
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (2951 bp)
Predicted protein sequence (380 aa)
Flexi ORF Clone FXC00756
Source Human adult brain
Rouge ID mKIAA1184 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 2951 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 380 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8N490 9.2e-168 100.0 Probable hydrol...
Homo sapiens
BAE89909 5.1e-167 99.7 unnamed protein...
Macaca fascicularis
AAH36457 3.9e-166 99.2 Paroxysmal nonk...
Homo sapiens
Q69ZP3 4.4e-160 96.1 Probable hydrol...
Mus musculus
NP_001128222 5.9e-160 95.8 myofibrillogene...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001279 124 286 PF00753 Beta-lactamase-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GACGTACAGGTTGGAAATCAG
Primer_r CTGGCTGACTCAAGGTACACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp