Order Kazusa clone(s) from : ![]() |
Product ID | ORK00513 |
---|---|
Accession No | AB002351 |
Description | synemin, intermediate filament protein, transcript variant A |
Clone name | hg01758y1 |
Vector information | |
cDNA sequence | DNA sequence (7381 bp) Predicted protein sequence (1614 aa) |
HaloTag ORF Clone |
FHC00513
![]() |
Flexi ORF Clone | FXC00513 |
Source | Human adult brain |
Rouge ID |
mKIAA0353
by Kazusa Mouse cDNA Project
|
Note | We replaced hg01758, former representative clones for KIAA0353 with hg01758y1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2525 bp |
---|---|
Genome contig ID | gi51511731f_97362771 |
PolyA signal sequence (AATAAA,-15) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (130542 - 130591) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 97462771 | 97493311 | 4 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | TCAAAACCACCAGTAGGAAAC |
---|---|
Primer_r | CTGCACACAAGAGAAATCAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCAAAACCACCAGTAGGAAAC |
Primer_r | CTGCACACAAGAGAAATCAAC |
PCR product length | 128 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |