KIAA0355

Product ID	ORK00514
Accession No	AB002353
Description	KIAA0355
Clone name	hg01881
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6657 bp) Predicted protein sequence (1082 aa)
HaloTag ORF Clone	FHC00514
Flexi ORF Clone	FXC00514
Source	Human adult brain
Rouge ID	mKIAA0355 by Kazusa Mouse cDNA Project

Length: 6657 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2606 bp
Genome contig ID	gi42406306f_39337317
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ATAACTATTGGCTTTATTAAAAATATACATTTAAT
Flanking genome sequence (200992 - 201041)	----+--------+--------+--------+--------+----* AATACTTTGTATCCTTGTTTAAAATGAACTGCAGAGGACATTATGTCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	39437317	39538307	14	99.4	Perfect prediction

Length: 1082 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH89862	99.0	hypothetical pr...	Pongo abelii
BAE02416	99.0	unnamed protein...	Macaca fascicularis
XP_001914828	95.2	hypothetical pr...	Equus caballus
XP_875223	94.9	hypothetical pr...	Bos taurus
XP_001090089	99.0	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CACAATGTCCTGCTGATGCCC
Primer_r	GTAATTCCAGGTGTGCGCTTG
PCR conditions	95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

Chromosome No. 19

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CACAATGTCCTGCTGATGCCC
Primer_r	GTAATTCCAGGTGTGCGCTTG
PCR product length	125 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles